dsrna synthesis Search Results


90
Promega dsrna synthesis kit
Dsrna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dsrna+synthesis/dsrna+synthesis+kit/pm36292746-52-44-50
Average 90 stars, based on 1 article reviews
dsrna synthesis kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega dsrna synthesis for rnai experiments
(A) follistatin <t>RNAi</t> head fragments regenerate slowly with small blastemas. Live images at the indicated time points post amputation. Asterisks mark a newly formed pharynx. Arrowheads indicate a blastema.
Dsrna Synthesis For Rnai Experiments, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dsrna+synthesis/dsrna+synthesis+for+rnai+experiments/pmc06475882-577-4-14
Average 90 stars, based on 1 article reviews
dsrna synthesis for rnai experiments - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
5 PRIME dsrna synthesis
Effects of RNAi knockdown of MCO genes on nymphs of P. stali . ( A ) Effects of RNAi on third instar nymphs, in which <t>dsRNA</t> for each MCO gene was injected into newly molted third instar nymphs. Note that knockdown of PsMCO2 led to high mortality during molting. ( B ) Phenotypes of newly molted fourth instar nymphs that were injected with either EGFP dsRNA as a control (left panel) or PsMCO2 dsRNA (right panel). All the PsMCO2 dsRNA-injected insects were not tanned. ( C ) Effects of RNAi on fifth instar nymphs. All the PsMCO2 dsRNA-injected insects died during molting. ( D ) A fifth instar nymph (left), a 1-day-old adult that were injected with EGFP dsRNA as a control (middle), and a typical image of molting failure induced by injection with PsMCO2 dsRNA (right). PsMCO2 RNAi causes incomplete molting. Arrowheads indicate nymphal (red) and adult (green) cuticles. Numbers above bars show sample sizes (i.e. biological replicates) in. ( A , C ) Scale bars show 5 mm in ( B , D ).
Dsrna Synthesis, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dsrna+synthesis/dsrna+synthesis/pmc07044228-50-4-25
Average 90 stars, based on 1 article reviews
dsrna synthesis - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Promega t7 ribomaxtm express system dsrna synthesis kit
Effects of RNAi knockdown of MCO genes on nymphs of P. stali . ( A ) Effects of RNAi on third instar nymphs, in which <t>dsRNA</t> for each MCO gene was injected into newly molted third instar nymphs. Note that knockdown of PsMCO2 led to high mortality during molting. ( B ) Phenotypes of newly molted fourth instar nymphs that were injected with either EGFP dsRNA as a control (left panel) or PsMCO2 dsRNA (right panel). All the PsMCO2 dsRNA-injected insects were not tanned. ( C ) Effects of RNAi on fifth instar nymphs. All the PsMCO2 dsRNA-injected insects died during molting. ( D ) A fifth instar nymph (left), a 1-day-old adult that were injected with EGFP dsRNA as a control (middle), and a typical image of molting failure induced by injection with PsMCO2 dsRNA (right). PsMCO2 RNAi causes incomplete molting. Arrowheads indicate nymphal (red) and adult (green) cuticles. Numbers above bars show sample sizes (i.e. biological replicates) in. ( A , C ) Scale bars show 5 mm in ( B , D ).
T7 Ribomaxtm Express System Dsrna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dsrna+synthesis/t7+ribomaxtm+express+system+dsrna+synthesis+kit/10__1016_slash_j__aspen__2020__10__015-54-23-30
Average 90 stars, based on 1 article reviews
t7 ribomaxtm express system dsrna synthesis kit - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
BGI Shenzhen primers of lve75 and egfp for dsrna synthesis
Effects of RNAi knockdown of MCO genes on nymphs of P. stali . ( A ) Effects of RNAi on third instar nymphs, in which <t>dsRNA</t> for each MCO gene was injected into newly molted third instar nymphs. Note that knockdown of PsMCO2 led to high mortality during molting. ( B ) Phenotypes of newly molted fourth instar nymphs that were injected with either EGFP dsRNA as a control (left panel) or PsMCO2 dsRNA (right panel). All the PsMCO2 dsRNA-injected insects were not tanned. ( C ) Effects of RNAi on fifth instar nymphs. All the PsMCO2 dsRNA-injected insects died during molting. ( D ) A fifth instar nymph (left), a 1-day-old adult that were injected with EGFP dsRNA as a control (middle), and a typical image of molting failure induced by injection with PsMCO2 dsRNA (right). PsMCO2 RNAi causes incomplete molting. Arrowheads indicate nymphal (red) and adult (green) cuticles. Numbers above bars show sample sizes (i.e. biological replicates) in. ( A , C ) Scale bars show 5 mm in ( B , D ).
Primers Of Lve75 And Egfp For Dsrna Synthesis, supplied by BGI Shenzhen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dsrna+synthesis/primers+of+lve75+and+egfp+for+dsrna+synthesis/pm32122820-76-2-15
Average 90 stars, based on 1 article reviews
primers of lve75 and egfp for dsrna synthesis - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


(A) follistatin RNAi head fragments regenerate slowly with small blastemas. Live images at the indicated time points post amputation. Asterisks mark a newly formed pharynx. Arrowheads indicate a blastema.

Journal: Cell reports

Article Title: Cellular and Molecular Responses Unique to Major Injury Are Dispensable for Planarian Regeneration

doi: 10.1016/j.celrep.2018.11.004

Figure Lengend Snippet: (A) follistatin RNAi head fragments regenerate slowly with small blastemas. Live images at the indicated time points post amputation. Asterisks mark a newly formed pharynx. Arrowheads indicate a blastema.

Article Snippet: Double-stranded RNA synthesis for RNAi experiments dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-generated forward and reverse templates with flanking T7 promoters (TAATACGACTCACTATAGGG).

Techniques:

(A) follistatin RNAi animals regenerate heads slowly after amputation at AP1. Live images at the indicated time points post amputation. Arrowheads indicate the first appearance of eyes.

Journal: Cell reports

Article Title: Cellular and Molecular Responses Unique to Major Injury Are Dispensable for Planarian Regeneration

doi: 10.1016/j.celrep.2018.11.004

Figure Lengend Snippet: (A) follistatin RNAi animals regenerate heads slowly after amputation at AP1. Live images at the indicated time points post amputation. Arrowheads indicate the first appearance of eyes.

Article Snippet: Double-stranded RNA synthesis for RNAi experiments dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-generated forward and reverse templates with flanking T7 promoters (TAATACGACTCACTATAGGG).

Techniques:

(A) Expression levels of wound-induced notum and inhibin-1 are normal after follistatin RNAi. FISH for notum (green) and inhibin-1 (yellow) at 6 hpa in regenerating tail fragments (ventral view). Black box indicates the region shown. Two independent experiments.

Journal: Cell reports

Article Title: Cellular and Molecular Responses Unique to Major Injury Are Dispensable for Planarian Regeneration

doi: 10.1016/j.celrep.2018.11.004

Figure Lengend Snippet: (A) Expression levels of wound-induced notum and inhibin-1 are normal after follistatin RNAi. FISH for notum (green) and inhibin-1 (yellow) at 6 hpa in regenerating tail fragments (ventral view). Black box indicates the region shown. Two independent experiments.

Article Snippet: Double-stranded RNA synthesis for RNAi experiments dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-generated forward and reverse templates with flanking T7 promoters (TAATACGACTCACTATAGGG).

Techniques: Expressing

(A) wnt1 RNAi suppresses the head regeneration defect after follistatin RNAi. Top: feeding regimen for RNAi. Bottom: live images of tail fragments at 14 dpa. Two independent experiments.

Journal: Cell reports

Article Title: Cellular and Molecular Responses Unique to Major Injury Are Dispensable for Planarian Regeneration

doi: 10.1016/j.celrep.2018.11.004

Figure Lengend Snippet: (A) wnt1 RNAi suppresses the head regeneration defect after follistatin RNAi. Top: feeding regimen for RNAi. Bottom: live images of tail fragments at 14 dpa. Two independent experiments.

Article Snippet: Double-stranded RNA synthesis for RNAi experiments dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-generated forward and reverse templates with flanking T7 promoters (TAATACGACTCACTATAGGG).

Techniques:

Effects of RNAi knockdown of MCO genes on nymphs of P. stali . ( A ) Effects of RNAi on third instar nymphs, in which dsRNA for each MCO gene was injected into newly molted third instar nymphs. Note that knockdown of PsMCO2 led to high mortality during molting. ( B ) Phenotypes of newly molted fourth instar nymphs that were injected with either EGFP dsRNA as a control (left panel) or PsMCO2 dsRNA (right panel). All the PsMCO2 dsRNA-injected insects were not tanned. ( C ) Effects of RNAi on fifth instar nymphs. All the PsMCO2 dsRNA-injected insects died during molting. ( D ) A fifth instar nymph (left), a 1-day-old adult that were injected with EGFP dsRNA as a control (middle), and a typical image of molting failure induced by injection with PsMCO2 dsRNA (right). PsMCO2 RNAi causes incomplete molting. Arrowheads indicate nymphal (red) and adult (green) cuticles. Numbers above bars show sample sizes (i.e. biological replicates) in. ( A , C ) Scale bars show 5 mm in ( B , D ).

Journal: Scientific Reports

Article Title: Diversity and function of multicopper oxidase genes in the stinkbug Plautia stali

doi: 10.1038/s41598-020-60340-8

Figure Lengend Snippet: Effects of RNAi knockdown of MCO genes on nymphs of P. stali . ( A ) Effects of RNAi on third instar nymphs, in which dsRNA for each MCO gene was injected into newly molted third instar nymphs. Note that knockdown of PsMCO2 led to high mortality during molting. ( B ) Phenotypes of newly molted fourth instar nymphs that were injected with either EGFP dsRNA as a control (left panel) or PsMCO2 dsRNA (right panel). All the PsMCO2 dsRNA-injected insects were not tanned. ( C ) Effects of RNAi on fifth instar nymphs. All the PsMCO2 dsRNA-injected insects died during molting. ( D ) A fifth instar nymph (left), a 1-day-old adult that were injected with EGFP dsRNA as a control (middle), and a typical image of molting failure induced by injection with PsMCO2 dsRNA (right). PsMCO2 RNAi causes incomplete molting. Arrowheads indicate nymphal (red) and adult (green) cuticles. Numbers above bars show sample sizes (i.e. biological replicates) in. ( A , C ) Scale bars show 5 mm in ( B , D ).

Article Snippet: Template preparation for double-stranded RNA (dsRNA) synthesis was performed by PCR using the primers designed (Table ) in combination with T7 promoter sequence at the 5-prime end.

Techniques: Knockdown, Injection, Control

Effects of maternal RNAi knockdown of PsMCO2 gene. ( A ) Expression levels of PsMCO2 in embryos estimated by quantitative RT-PCR in terms of PsMCO2 cDNA copies per ribosomal protein L32 (rpL32) cDNA copies. RNA was extracted from day 4 egg masses that were laid by females 1, 2, 4 and 5 days after dsRNA injection. ( B ) Egg hatching rates. Sexually mature females were injected with either EGFP dsRNA as a control or PsMCO2 dsRNA and hatching rate of each egg mass was observed. Hatching rates significantly differ between the control eggs and the PsMCO2 knockdown eggs from 4 days after injection and onward. Mean egg hatching rates of egg masses are shown with standard deviations. Numbers above bars show sample sizes (i.e. biological replicates). ( C ) Phenotypes of eggs laid by females injected with either EGFP dsRNA as a control or PsMCO2 dsRNA. Eyespots and egg bursters are seen through the eggshell of 4-day-old eggs irrespective of the treatments. Subsequently, however, eggs laid by females injected with PsMCO2 did not hatch (6d) and became blackened (8d). ( D ) Close-up view of an egg from a mother that was injected with PsMCO2 dsRNA. The developed egg (fourth day after egg laying; bottom) shows obvious eyespots and an egg burster, whereas the undeveloped egg (first day after egg laying; upper) does not. Arrowheads indicate eyespots (red) and egg-burster (green). ( E ) Ovaries of sexually mature females injected with Cy3-labelled dsRNA (right) or non-labelled dsRNA (left), which are observed under light microscope (upper) and fluorescent microscope (bottom). Scale bar shows 1 mm.

Journal: Scientific Reports

Article Title: Diversity and function of multicopper oxidase genes in the stinkbug Plautia stali

doi: 10.1038/s41598-020-60340-8

Figure Lengend Snippet: Effects of maternal RNAi knockdown of PsMCO2 gene. ( A ) Expression levels of PsMCO2 in embryos estimated by quantitative RT-PCR in terms of PsMCO2 cDNA copies per ribosomal protein L32 (rpL32) cDNA copies. RNA was extracted from day 4 egg masses that were laid by females 1, 2, 4 and 5 days after dsRNA injection. ( B ) Egg hatching rates. Sexually mature females were injected with either EGFP dsRNA as a control or PsMCO2 dsRNA and hatching rate of each egg mass was observed. Hatching rates significantly differ between the control eggs and the PsMCO2 knockdown eggs from 4 days after injection and onward. Mean egg hatching rates of egg masses are shown with standard deviations. Numbers above bars show sample sizes (i.e. biological replicates). ( C ) Phenotypes of eggs laid by females injected with either EGFP dsRNA as a control or PsMCO2 dsRNA. Eyespots and egg bursters are seen through the eggshell of 4-day-old eggs irrespective of the treatments. Subsequently, however, eggs laid by females injected with PsMCO2 did not hatch (6d) and became blackened (8d). ( D ) Close-up view of an egg from a mother that was injected with PsMCO2 dsRNA. The developed egg (fourth day after egg laying; bottom) shows obvious eyespots and an egg burster, whereas the undeveloped egg (first day after egg laying; upper) does not. Arrowheads indicate eyespots (red) and egg-burster (green). ( E ) Ovaries of sexually mature females injected with Cy3-labelled dsRNA (right) or non-labelled dsRNA (left), which are observed under light microscope (upper) and fluorescent microscope (bottom). Scale bar shows 1 mm.

Article Snippet: Template preparation for double-stranded RNA (dsRNA) synthesis was performed by PCR using the primers designed (Table ) in combination with T7 promoter sequence at the 5-prime end.

Techniques: Knockdown, Expressing, Quantitative RT-PCR, Injection, Control, Light Microscopy, Microscopy

Effects of maternal RNAi knockdown of 7 MCO and 3 tyrosinase genes on egg production and hatching. Six sexually mature females were injected with each MCO or tyrosinase dsRNA. Total number of egg masses oviposited from 4 to 7 days after injection ( A ), mean number of eggs in each egg mass ( B ) and egg hatching rates ( C ) are shown. No significant differences were observed among them except for the hatching rate for RNAi of PsMCO2 (Steel-Dwass test; P < 0.05).

Journal: Scientific Reports

Article Title: Diversity and function of multicopper oxidase genes in the stinkbug Plautia stali

doi: 10.1038/s41598-020-60340-8

Figure Lengend Snippet: Effects of maternal RNAi knockdown of 7 MCO and 3 tyrosinase genes on egg production and hatching. Six sexually mature females were injected with each MCO or tyrosinase dsRNA. Total number of egg masses oviposited from 4 to 7 days after injection ( A ), mean number of eggs in each egg mass ( B ) and egg hatching rates ( C ) are shown. No significant differences were observed among them except for the hatching rate for RNAi of PsMCO2 (Steel-Dwass test; P < 0.05).

Article Snippet: Template preparation for double-stranded RNA (dsRNA) synthesis was performed by PCR using the primers designed (Table ) in combination with T7 promoter sequence at the 5-prime end.

Techniques: Knockdown, Injection